View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_63 (Length: 241)
Name: NF1492_low_63
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 33505441 - 33505208
Alignment:
| Q |
1 |
gttgcatggtttcgttgcatggctattaacacgtgacccctactaatccctcccacgtagcaccctttcggtgtctcatatatattacttagcatcaaag |
100 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33505441 |
gttgcatgcttgcattgcatggctattaacacgtggcacctactaatccctcccacgtatcaccctttcggtgtctcatatatattacttagcatcaaag |
33505342 |
T |
 |
| Q |
101 |
agatcaagagaggaaataagaaattaactgcaaacaaacggttatggcgatgaagctcaagtatctatcctccattgctgaggatgttgttgctagatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33505341 |
agatcaagagaggaaataagaaattaactgcaaacaaacggttatggcgatgaagctcaagtatctatcctccattgctgaggatgttgttgctagatgt |
33505242 |
T |
 |
| Q |
201 |
gcacagtacgtaatattaatactctcctattcat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33505241 |
gcacagtacgtaatattaatactctcctattcat |
33505208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University