View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_64 (Length: 238)
Name: NF1492_low_64
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 9298502 - 9298325
Alignment:
| Q |
18 |
ctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgtttttgttgtcaggtttgtaacacctttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9298502 |
ctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgtttttgttgtcaggtttggaacacctttt |
9298403 |
T |
|
| Q |
118 |
tctttgttgttcatcattagatactagatcttctcacaattatgtttttttctttcggatctgtcggtttctgccatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298402 |
tctttgttgttcatcattagatactagatcttctcacaattatgtttttttctttcggatctgtcggtttctgccatg |
9298325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University