View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_65 (Length: 237)
Name: NF1492_low_65
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 30715918 - 30715978
Alignment:
| Q |
1 |
tggtgtttattaatcaatattgtagatattgtcaatacatgtagtggtgttgtcctagttt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30715918 |
tggtgtttattaatcaatattgtagatattgttaatatatgtagtggtgttgtcctagttt |
30715978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 90
Target Start/End: Original strand, 30734369 - 30734427
Alignment:
| Q |
32 |
tcaatacatgtagtggtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggt |
90 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30734369 |
tcaatatatgtagtggtgttgtcctagtttaaattgtgctcaaaatgaatatggtgggt |
30734427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 115
Target Start/End: Original strand, 30716028 - 30716097
Alignment:
| Q |
47 |
gtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggtgttgatgagtttg-aatatgatgatc |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
30716028 |
gtgttgtcctagtttaaattgtgctcaaaatgaataaggtgggtgttgatgaatttgaaatatgatgatc |
30716097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 222
Target Start/End: Original strand, 30734895 - 30734952
Alignment:
| Q |
167 |
tttatgacatgtctatcaaacagaatt--tagtgatgcaatcaaacaaaaagaaatat |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30734895 |
tttatgacatgtctatcaaacggaatttatagtgttgcaatcaaacaaaaagaaatat |
30734952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University