View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_71 (Length: 220)
Name: NF1492_low_71
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 2 - 144
Target Start/End: Complemental strand, 24620489 - 24620347
Alignment:
| Q |
2 |
catcacaccctttaaatcatataattcgtacgtgtgttttgagagatccaatagaaggtttaaagtatgtttgtctttcattttcctattctatttttgg |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620489 |
catcacaccatttaaatcatataattcgtacgtgtgttttgagagatccaatagaaggtttaaagtatgtttgtctttcattttcctattctatttttgg |
24620390 |
T |
 |
| Q |
102 |
ttaaagattcaagtggccatacatgatgtttagtaccttacat |
144 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
24620389 |
ttaaagattcatgtggtcatacatgatgtttagtacattacat |
24620347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 220
Target Start/End: Complemental strand, 24620313 - 24620276
Alignment:
| Q |
183 |
gttaagactagtctttcatgtctattttaaagttgatt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24620313 |
gttaaaactagtctttcatgtctattttaaagttgatt |
24620276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University