View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_72 (Length: 209)
Name: NF1492_low_72
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 181
Target Start/End: Complemental strand, 44097524 - 44097399
Alignment:
| Q |
56 |
aaggttgaaagagtacagttacataattggatggtttttataaattagtttctaaggtatggaaagaaagaagggagccaggtttgtagatttagctaga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44097524 |
aaggttgaaagagtacagttacataattggatggtttttataaatttgtttctaaggtatggaaagaaagaagggacccaggtttgtagatttagctaga |
44097425 |
T |
|
| Q |
156 |
aagatgaggtatttaattgtgggatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44097424 |
aagatgaggtatttaattgtgggatt |
44097399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University