View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_74 (Length: 204)
Name: NF1492_low_74
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 22956955 - 22956783
Alignment:
| Q |
16 |
aatataaaaatggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22956955 |
aatataaaaatggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttg |
22956856 |
T |
|
| Q |
116 |
ctcaacaatacgtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtgtgaaaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22956855 |
ctcaacaatacgtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtttgaaaaa |
22956783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University