View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14930_high_5 (Length: 253)

Name: NF14930_high_5
Description: NF14930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14930_high_5
NF14930_high_5
[»] chr8 (1 HSPs)
chr8 (1-235)||(16497171-16497405)
[»] chr1 (2 HSPs)
chr1 (1-235)||(40778733-40778967)
chr1 (174-235)||(49619519-49619581)
[»] chr3 (2 HSPs)
chr3 (21-177)||(34224375-34224531)
chr3 (175-235)||(36627269-36627330)
[»] scaffold0034 (1 HSPs)
scaffold0034 (192-235)||(98399-98442)
[»] chr7 (1 HSPs)
chr7 (174-216)||(29657376-29657419)
[»] chr5 (1 HSPs)
chr5 (173-216)||(14357570-14357614)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 16497405 - 16497171
Alignment:
1 caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
16497405 caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttggaagcttggtttttgatcttgaaaatgtattcgattggatcttc 16497306  T
101 gaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16497305 gaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg 16497206  T
201 gagttaatgggttttgatgatccgattttgaatga 235  Q
    ||||| |||||||||||||||||||||||||||||    
16497205 gagttgatgggttttgatgatccgattttgaatga 16497171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40778967 - 40778733
Alignment:
1 caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttc 100  Q
    |||| |||||||||||| ||||||||||||||||||||||||||||| | |||||| |||||||||||| |||||| |||||||||||||||||||||||    
40778967 caaatgggtcgtttaacaggggaaaaggagggatgattttgcagattccgaatttggaagcttggttttcgatctttaaaatgtattcgattggatcttc 40778868  T
101 gaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
40778867 gaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttgattttggtgatagatagttctttttg 40778768  T
201 gagttaatgggttttgatgatccgattttgaatga 235  Q
    |||||||||||||||| ||||||||||||||||||    
40778767 gagttaatgggttttggtgatccgattttgaatga 40778733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 174 - 235
Target Start/End: Original strand, 49619519 - 49619581
Alignment:
174 gattttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatga 235  Q
    ||||||||||| |||||||| | ||||||||||||||||||||| ||||| ||||||||||||    
49619519 gattttggtgaaagaaagtttcgttttggagttaatgggttttggtgatctgattttgaatga 49619581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 21 - 177
Target Start/End: Original strand, 34224375 - 34224531
Alignment:
21 ggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttcgaattcagctggagtgggtt 120  Q
    |||||||||||||| |||||||||||| | |||||| |||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||     
34224375 ggaaaaggagggataattttgcagattccgaatttggaagcttcgttttcgatcttgaaaatgtatgcgattggatcttcgaattcagctggagtgggtc 34224474  T
121 ggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgatt 177  Q
    |||||||||| |||||||||||| ||||||||||||||||||| || ||||||||||    
34224475 ggtattcgggagctactggcatggattttaaccatgggaatacgtcgccgtttgatt 34224531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 36627330 - 36627269
Alignment:
175 attttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatga 235  Q
    ||||||||||  ||||||| ||||||||||||||||| ||||| |||||| |||||| ||||    
36627330 attttggtgaatgaaagtttctttttggagttaatggcttttggtgatccaattttggatga 36627269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 192 - 235
Target Start/End: Complemental strand, 98442 - 98399
Alignment:
192 ttctttttggagttaatgggttttgatgatccgattttgaatga 235  Q
    ||||||||||||||||||||||||| ||||||||||||||||||    
98442 ttctttttggagttaatgggttttggtgatccgattttgaatga 98399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 29657419 - 29657376
Alignment:
174 gattttggtgatagaaagtt-ctttttggagttaatgggttttg 216  Q
    |||||||||||||||||||| |||||||||||||||| ||||||    
29657419 gattttggtgatagaaagtttctttttggagttaatgagttttg 29657376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 14357570 - 14357614
Alignment:
173 tgattttggtgatagaaagtt-ctttttggagttaatgggttttg 216  Q
    |||||||||||||| |||||| |||||||||||||||| ||||||    
14357570 tgattttggtgataaaaagtttctttttggagttaatgagttttg 14357614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University