View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14930_low_6 (Length: 253)
Name: NF14930_low_6
Description: NF14930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14930_low_6 |
 | |
|
| [»] scaffold0034 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 16497405 - 16497171
Alignment:
| Q |
1 |
caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497405 |
caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttggaagcttggtttttgatcttgaaaatgtattcgattggatcttc |
16497306 |
T |
|
| Q |
101 |
gaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497305 |
gaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg |
16497206 |
T |
|
| Q |
201 |
gagttaatgggttttgatgatccgattttgaatga |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16497205 |
gagttgatgggttttgatgatccgattttgaatga |
16497171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40778967 - 40778733
Alignment:
| Q |
1 |
caaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttc |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| | |||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40778967 |
caaatgggtcgtttaacaggggaaaaggagggatgattttgcagattccgaatttggaagcttggttttcgatctttaaaatgtattcgattggatcttc |
40778868 |
T |
|
| Q |
101 |
gaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgattttggtgatagaaagttctttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40778867 |
gaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttgattttggtgatagatagttctttttg |
40778768 |
T |
|
| Q |
201 |
gagttaatgggttttgatgatccgattttgaatga |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
40778767 |
gagttaatgggttttggtgatccgattttgaatga |
40778733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 174 - 235
Target Start/End: Original strand, 49619519 - 49619581
Alignment:
| Q |
174 |
gattttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatga |
235 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
49619519 |
gattttggtgaaagaaagtttcgttttggagttaatgggttttggtgatctgattttgaatga |
49619581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 21 - 177
Target Start/End: Original strand, 34224375 - 34224531
Alignment:
| Q |
21 |
ggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttcgaattcagctggagtgggtt |
120 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||| |||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34224375 |
ggaaaaggagggataattttgcagattccgaatttggaagcttcgttttcgatcttgaaaatgtatgcgattggatcttcgaattcagctggagtgggtc |
34224474 |
T |
|
| Q |
121 |
ggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgatt |
177 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
34224475 |
ggtattcgggagctactggcatggattttaaccatgggaatacgtcgccgtttgatt |
34224531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 36627330 - 36627269
Alignment:
| Q |
175 |
attttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatga |
235 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| ||||| |||||| |||||| |||| |
|
|
| T |
36627330 |
attttggtgaatgaaagtttctttttggagttaatggcttttggtgatccaattttggatga |
36627269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 192 - 235
Target Start/End: Complemental strand, 98442 - 98399
Alignment:
| Q |
192 |
ttctttttggagttaatgggttttgatgatccgattttgaatga |
235 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
98442 |
ttctttttggagttaatgggttttggtgatccgattttgaatga |
98399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 29657419 - 29657376
Alignment:
| Q |
174 |
gattttggtgatagaaagtt-ctttttggagttaatgggttttg |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
29657419 |
gattttggtgatagaaagtttctttttggagttaatgagttttg |
29657376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 14357570 - 14357614
Alignment:
| Q |
173 |
tgattttggtgatagaaagtt-ctttttggagttaatgggttttg |
216 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
14357570 |
tgattttggtgataaaaagtttctttttggagttaatgagttttg |
14357614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University