View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14931_low_5 (Length: 228)
Name: NF14931_low_5
Description: NF14931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14931_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 10133016 - 10132812
Alignment:
| Q |
18 |
atgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagannnnnnnggttaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10133016 |
atgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagatttttttggttaaaca |
10132917 |
T |
 |
| Q |
118 |
tgttattactttattggggtaaagtattactgtctgtttttgccacctttagtagttattatgctcggaactatgactgaccatctttagtggagtctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
10132916 |
tgttattactttattggggtaaagtattacagtctgtttttgccacctttagtagttactatgctcagaactatgactgaccatctttagtggaatctct |
10132817 |
T |
 |
| Q |
218 |
gctcc |
222 |
Q |
| |
|
||||| |
|
|
| T |
10132816 |
gctcc |
10132812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University