View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14931_low_7 (Length: 213)

Name: NF14931_low_7
Description: NF14931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14931_low_7
NF14931_low_7
[»] chr5 (2 HSPs)
chr5 (138-213)||(32168817-32168892)
chr5 (16-76)||(32168956-32169016)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 138 - 213
Target Start/End: Complemental strand, 32168892 - 32168817
Alignment:
138 caaaatgttgataccatcccttttattcagattatgttattctctattaaagaaaaacaatcaacaattttcataa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32168892 caaaatgttgataccatcccttttattcagattatgttattctctattaaagaaaaacaatcaacaattttcataa 32168817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 32169016 - 32168956
Alignment:
16 gtgttgtcaattgatgaataatgtctcgattgtgcttatacaaatattacatccacaatct 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32169016 gtgttgtcaattgatgaataatgtctcgattgtgcttatacaaatattacatccacaatct 32168956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University