View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14931_low_7 (Length: 213)
Name: NF14931_low_7
Description: NF14931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14931_low_7 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 138 - 213
Target Start/End: Complemental strand, 32168892 - 32168817
Alignment:
| Q |
138 |
caaaatgttgataccatcccttttattcagattatgttattctctattaaagaaaaacaatcaacaattttcataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168892 |
caaaatgttgataccatcccttttattcagattatgttattctctattaaagaaaaacaatcaacaattttcataa |
32168817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 32169016 - 32168956
Alignment:
| Q |
16 |
gtgttgtcaattgatgaataatgtctcgattgtgcttatacaaatattacatccacaatct |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169016 |
gtgttgtcaattgatgaataatgtctcgattgtgcttatacaaatattacatccacaatct |
32168956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University