View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14932_high_11 (Length: 213)
Name: NF14932_high_11
Description: NF14932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14932_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 7184163 - 7183983
Alignment:
| Q |
17 |
acctttcaccatctttcccaaacttcttatcgcggggattctagaatctgcttttcgctccgggatgtcattgctttgccgaccttttgcatctcttcgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7184163 |
acctttcaccatctttcccaaacttcttatcgcggggattctaga-tcttcttttcgctccgggatgtcattgctttgtcgaccttttgcatctcttcgt |
7184065 |
T |
 |
| Q |
117 |
actgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtcttttctgatgttatccacgaacttcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7184064 |
actgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtcttttctgatgttatccacgaacttcat |
7183983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University