View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14932_low_11 (Length: 333)
Name: NF14932_low_11
Description: NF14932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14932_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 188 - 325
Target Start/End: Complemental strand, 48956036 - 48955903
Alignment:
| Q |
188 |
ggaagcaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaattaatggacacattcctacctttaccttttccttcagatctgat |
287 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48956036 |
ggaaccaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaat----ggacacattcctacctttaccttttccttcagatttgat |
48955941 |
T |
|
| Q |
288 |
tcaatccttaattatgtctccttttggttattttcttc |
325 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48955940 |
tcaatccttaattgtgtctccttttggttattttcttc |
48955903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 40 - 132
Target Start/End: Complemental strand, 48956198 - 48956092
Alignment:
| Q |
40 |
agcagtctaatcacggcaccacacttaaatcaatgacatgaaaagagaaaa--------------agagagtaggcttttgttgaatttggacctggact |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48956198 |
agcagtctaatcacggcaccacacttaaatcaatgacatgaaaagagaaaaggagagagagagagagagagtaggcttttgttgaatttggacctgcact |
48956099 |
T |
|
| Q |
126 |
tgtgtga |
132 |
Q |
| |
|
||||||| |
|
|
| T |
48956098 |
tgtgtga |
48956092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University