View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14932_low_15 (Length: 213)

Name: NF14932_low_15
Description: NF14932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14932_low_15
NF14932_low_15
[»] chr3 (1 HSPs)
chr3 (17-198)||(7183983-7184163)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 7184163 - 7183983
Alignment:
17 acctttcaccatctttcccaaacttcttatcgcggggattctagaatctgcttttcgctccgggatgtcattgctttgccgaccttttgcatctcttcgt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||    
7184163 acctttcaccatctttcccaaacttcttatcgcggggattctaga-tcttcttttcgctccgggatgtcattgctttgtcgaccttttgcatctcttcgt 7184065  T
117 actgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtcttttctgatgttatccacgaacttcat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7184064 actgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtcttttctgatgttatccacgaacttcat 7183983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University