View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14932_low_6 (Length: 379)
Name: NF14932_low_6
Description: NF14932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14932_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 96 - 356
Target Start/End: Complemental strand, 30105706 - 30105446
Alignment:
| Q |
96 |
ctggggttgatattatggtgggatagattagtttgagtggtgtgggaccattaactttggctattcataatcaaacaaatggtgggtatagattctttca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30105706 |
ctggggttgatattatggtgggatagattagtttgagtggtgtgggaccattaactttggctattcataatcaaacagatggtgggtatagattctttca |
30105607 |
T |
 |
| Q |
196 |
atgtggaagggaaataagtgagttccctgttatgtttcctattccattgcctttctttagtacctttgtgactactccacatagcttttacgtacatcct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30105606 |
atgtggaagggaaataagtgagttccctgttatgtttcctattccattgcctttctttagtacctttgtgactactacacatagcttttatgtacatcct |
30105507 |
T |
 |
| Q |
296 |
tttgcaggtatattttgtagaatatattgtgcatcattcttgagtgtgataatgaagtatg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30105506 |
tttgcaggtatattttgtagaatatattgtgcatcattcttgagtgtgataatgaagtatg |
30105446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 47
Target Start/End: Complemental strand, 30105789 - 30105754
Alignment:
| Q |
12 |
atgatgatggtggtgatgtggcagattagattatga |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30105789 |
atgatgatggtggtgatgtggcagattagattatga |
30105754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University