View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14933_low_12 (Length: 298)
Name: NF14933_low_12
Description: NF14933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14933_low_12 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 9 - 273
Target Start/End: Complemental strand, 3467 - 3203
Alignment:
| Q |
9 |
ggacatcatcggctacggtcgagtttagtattagaaccatgttttgatgaactacatgcactttctatgccattgaagagttcatttgagagagataaag |
108 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3467 |
ggacaacatcggctacggtcgagtttactattagaaccatgttttgatgaactacatgcactttctatgccattgaagagttcatttgagagagataaag |
3368 |
T |
|
| Q |
109 |
gacagcctttaacatatgactgttcttggaatgaagggattgttaatgttgttgggaaaatgggattaagggttgatgatgttgagttaggatgagtgag |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3367 |
gacagcctttaacataagactgttcttggaatgaagggattgttaatgttgttgggaaaatgggattaagggttgatgatgttgagttaggatgagtgag |
3268 |
T |
|
| Q |
209 |
actcatgtaggaagggaagaagagaatgtagaggaaaaggatcattagatatggaagtggaagtg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3267 |
actcatgtaggaagggaagaagagaatgtagaggaaaaggatcatttgatatggaagtggaagtg |
3203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University