View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14934_low_16 (Length: 302)
Name: NF14934_low_16
Description: NF14934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14934_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 111 - 288
Target Start/End: Complemental strand, 5984200 - 5984023
Alignment:
| Q |
111 |
aataacctttggtggcgacttcattgttttttgagcaaccctcaaatttttaggtcgcttcaagtaccctatatggttccttccagtttggattcgactc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5984200 |
aataacctttggtggcgacttcattgttttttgagcaaccctcaaatttttaggtcgcttcaagtaccctatatggttccttctagtttggattcgactc |
5984101 |
T |
 |
| Q |
211 |
tactttcctgagtttctacataaagtttgaaaagtttaaaaggcctgaactaggtcagttcatgtgggagtcaatgat |
288 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5984100 |
tactttcctgagtttctacagaaagtttgaaaagtttaaaaggcctgaactaggtcagttcatgtgggagtcaatgat |
5984023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 5984293 - 5984245
Alignment:
| Q |
10 |
taatacttttcctatgcataatccacttccaaatctaaaatctggtttt |
58 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5984293 |
taatacttttcctatgcataatcgacttccaaatctaaaatctggtttt |
5984245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University