View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14934_low_26 (Length: 250)
Name: NF14934_low_26
Description: NF14934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14934_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 237
Target Start/End: Complemental strand, 44002004 - 44001774
Alignment:
| Q |
7 |
tcgaagaatatcacacacttattgagtatcgtaaaagcacaaactcttttcaatgtgcttcctaagttagttcctataaatactctcatttaccaccatt |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44002004 |
tcgaataaaatcacacacttattgagtatcgtaaaagcacaacctcttttcaatgtgcttcctaagttagttcctataaatactctcatttaccaccatt |
44001905 |
T |
|
| Q |
107 |
tcatttcaaaataacctcaaccatcatatataattttctatctcacttaaacttccaaacccaatacaaccatcagatcgaattcagtttcgattcgatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44001904 |
tcatttcaaaataacctcaaccatcatatataattttctatctcacttaaacttccaaacccaatacaaccatcagatcgaattcagattcgattcgatc |
44001805 |
T |
|
| Q |
207 |
tggtggtttgggcggtctaaataactcttaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44001804 |
tggtggtttgggcggtctaaataactcttaa |
44001774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University