View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14934_low_29 (Length: 236)
Name: NF14934_low_29
Description: NF14934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14934_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21492523 - 21492302
Alignment:
| Q |
1 |
ctcaatgcattcggttcaattctgagcatatatttcatcgacaaaactgggaggaagaaacttgcattgattagtttaaccggtgttgtcctttctctga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21492523 |
ctcaatgcattcggttcaattctgagcatatatttcatcgacaaaactgggaggaagaaacttgcattgattagtttgaccggtgttgtcctttctctga |
21492424 |
T |
 |
| Q |
101 |
ctcttttaaccgtcacttttcgtgaaagtgaaattcatgcaccaatggttagtgtcatcgaaagctctcatttaaataacacatgccctgagttcaagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21492423 |
ctcttttaaccgtcacttttcgtgaaagtgaaattcatgcaccaatggttagtctcgttgaaagctctcattacaataacacatgccctgagttcaagac |
21492324 |
T |
 |
| Q |
201 |
agcagctacgaacaatcataat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21492323 |
agcagctacgaacaatcataat |
21492302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 33116351 - 33116403
Alignment:
| Q |
25 |
agcatatatttcatcgacaaaactgggaggaagaaacttgcattgattagttt |
77 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||| || || ||||||||||| |
|
|
| T |
33116351 |
agcatatatttcatcgataaaaccgggagaaagaagctagctttgattagttt |
33116403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University