View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14934_low_31 (Length: 227)
Name: NF14934_low_31
Description: NF14934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14934_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 50087269 - 50087049
Alignment:
| Q |
7 |
gaagcatcaaggatgacactgcataggtttggtaatacatcttcatcatcactatggtatgaacttaactacattgaatcaaaaggtaggatgaagaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50087269 |
gaagcatcaaggatgacactgcataggtttggtaatacatcttcatcatcactatggtatgaacttaactacattgaatcaaaaggtaggatgaagaaag |
50087170 |
T |
 |
| Q |
107 |
gagacagggtatggcagatagcatttggcagtggatttaaatgcaatagtgctgtttggaaatgtaacagaagcattaagacacctattgatggaccttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50087169 |
gagacagggtatggcagatagcatttggcagtggatttaaatgcaatagtgctgtttggaaatgtaacagaagcattaagacacctattgatggaccttg |
50087070 |
T |
 |
| Q |
207 |
gacagattgcattgatcgtta |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50087069 |
gacagattgcattgatcgtta |
50087049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 23271524 - 23271313
Alignment:
| Q |
13 |
tcaaggatgacactgcataggtttggtaatacatcttcatcatcactatggtatgaacttaactacattgaatcaaaaggtaggatgaagaaaggagaca |
112 |
Q |
| |
|
||||| ||||| |||||| | || || || |||||||| ||||| ||||||||||| | ||||| |||||||||||||| |||||||||| ||| || | |
|
|
| T |
23271524 |
tcaagaatgacgctgcatcgattcgggaacacatcttcttcatctttatggtatgaattgaactatattgaatcaaaaggaaggatgaagagaggtgata |
23271425 |
T |
 |
| Q |
113 |
gggtatggcagatagcatttggcagtggatttaaatgcaatagtgctgtttggaaatgtaacagaagcattaagacacctattgatggaccttggacaga |
212 |
Q |
| |
|
| |||||||| ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| || ||||||||||| ||| |
|
|
| T |
23271424 |
gagtatggcaaatagcttttggaagtggatttaaatgcaatagtgctgtgtggaaatgtaatagaagcattaaaacacctgttaatggaccttgggaaga |
23271325 |
T |
 |
| Q |
213 |
ttgcattgatcg |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23271324 |
ttgcattgatcg |
23271313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University