View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14936_low_17 (Length: 297)
Name: NF14936_low_17
Description: NF14936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14936_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 27 - 212
Target Start/End: Original strand, 48362462 - 48362649
Alignment:
| Q |
27 |
ctaagtcggctaattagatgaaattttaacaatgattaatggattttcagaccctacattgttctggttgtggtttttcagaccccacttattatctttt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48362462 |
ctaagtcggctaattagatgaaattttaacaatgattaatggattttcagaccctacattgctctggttgtggtttttcagaccccacttattatctttt |
48362561 |
T |
 |
| Q |
127 |
gatttagatttggatttggcttcttaatagtagaagaatatcaattacttctcccggcttataata--ttttcacatttacaaaataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48362562 |
gatttagatttggatttggcttcttaatagtagaagaatatcaattacttctcccggcttataatattttttcacatttacaaaataa |
48362649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University