View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14936_low_22 (Length: 247)
Name: NF14936_low_22
Description: NF14936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14936_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 185050 - 184833
Alignment:
| Q |
15 |
caaaggaagaaagtgctgacaataattgcctcagcaattccaataattacgaccactctaacagctcccttagctgtctttggatttcctgctcctaatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185050 |
caaaggaagaaagtgctgacaataattgcctcagcaattccaataattacaaccactctaacagctcccttagctgtctttggatttcctgctcctaatt |
184951 |
T |
 |
| Q |
115 |
catttgaaacacgagtactgcgaaaaacaaacaaacatcatggcatgggagagatcaaaaacagaagatcttgcaatatcatatgatattattattgtta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
184950 |
catttgaaacacgagtactgcgaaaaacaaacaaacatcatggcatgggagagatcaaaaacagaagatcttgcaatatcatatgatattattattgtta |
184851 |
T |
 |
| Q |
215 |
tgattgtgtcacatatgt |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
184850 |
tgattgtgtcacatatgt |
184833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 27 - 141
Target Start/End: Original strand, 31752063 - 31752177
Alignment:
| Q |
27 |
gtgctgacaataattgcctcagcaattccaataattacgaccactctaacagctcccttagctgtctttggatttcctgctcctaattcatttgaaacac |
126 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| | |||| |||||| || || || | | ||||||| ||||||||||||||||| ||||| | |
|
|
| T |
31752063 |
gtgctgactataactgcctcagcaattccaataattacagcaactcgaacagcaccttttgccgcccttggattccctgctcctaattcattcgaaactc |
31752162 |
T |
 |
| Q |
127 |
gagtactgcgaaaaa |
141 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
31752163 |
gagtactgcaaaaaa |
31752177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University