View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14936_low_27 (Length: 232)
Name: NF14936_low_27
Description: NF14936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14936_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 41 - 216
Target Start/End: Complemental strand, 46938717 - 46938539
Alignment:
| Q |
41 |
ggaattttgcttgttggatgattgagctttttgcaatgaaccccacaaaatatttaataggtgaaagccaacttaacgaaaccatgtgtttgatattatg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46938717 |
ggaattttgcttgttggatgattgagctttttgcaatgaaccccacaaaatatttaataggtgaaagccaacttaacgaaaccatgtgtttgatattatg |
46938618 |
T |
|
| Q |
141 |
tatctctatttcattggataaaataattgaaactggtccaattcaatgaa---ttatatatatcaatgatctagcaaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46938617 |
tatctctatttcattggataaaataattgaaactggtccaattcaatgaattattatatatatcaatgatctagcaaac |
46938539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University