View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14936_low_28 (Length: 223)
Name: NF14936_low_28
Description: NF14936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14936_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 35610432 - 35610241
Alignment:
| Q |
14 |
aatatacatcgttttgatctttggacaactttttccaggcacctttttggtatgatgagatgtctatgcgtacatataattgtaaattgttatgagcgac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
35610432 |
aatatacatcgttttgatctttggacaactttttccaggcacctttttggtatgatgagatgtctatgcgtacatataattgtaaattgttttgagtgac |
35610333 |
T |
|
| Q |
114 |
tttgcacatcttatgctagtttgtccataatcaataaactttagtttaacatnnnnnnnnnnnnnttcgcaagcaggtttagaatattaaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35610332 |
tttgcacatcttatgctagtttgtccataatcaataaactttagtttaacataaaaaataaaaaattcgcaagcaggtttagaatattaaaa |
35610241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University