View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14937_low_4 (Length: 431)
Name: NF14937_low_4
Description: NF14937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14937_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 1e-51; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 182 - 301
Target Start/End: Complemental strand, 9052881 - 9052763
Alignment:
| Q |
182 |
taattttgatgctcctaaaaaatggtatcctgagttgtcacacctcccgcccataccaaggtccacacctaagcgaaatatagaactttcatttaattta |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9052881 |
taattttgatgctcctaaaaaatggtatcctgagttgtcacccctcccgcccataccaaa-tccacacctaagcgaaatatagaactttcatttaattta |
9052783 |
T |
|
| Q |
282 |
atatctaatgtactaaagag |
301 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9052782 |
atatctaatgtactaaagag |
9052763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 16 - 92
Target Start/End: Complemental strand, 9053128 - 9053052
Alignment:
| Q |
16 |
gttttgatgcaatgcaactaaagacaattttagcaaaattagagtcgatcctaagatattttgtgccccgagcaaat |
92 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9053128 |
gttttgaagcaatgcaacaaaagacaattttagcaaaattagagtcgatcctaagatattttgtgccccgagcaaat |
9053052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 376 - 431
Target Start/End: Complemental strand, 9052688 - 9052633
Alignment:
| Q |
376 |
ggaaagaatattgttacaatttctttttgtttttaaggaatattgttacaatttct |
431 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
9052688 |
ggaaagaatattgttacaatttcttttttttttgaaggaatattgttacaatttct |
9052633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University