View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14937_low_5 (Length: 325)
Name: NF14937_low_5
Description: NF14937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14937_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 44854078 - 44853803
Alignment:
| Q |
19 |
agaagcaacgcgggaaaactccatcacagtcacgaccgagcataatgccggagctaccggaggtagaggcggcgagaagagcggcggaagagaactgtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44854078 |
agaagcaacgcgggaaaactccatcacagtcacgaccgagcataatgccggagctaccggaggtagaggcggcgagaagagcggtggaagagaactgtat |
44853979 |
T |
 |
| Q |
119 |
cggaaagaagataaccaaatgcatcgttgccgatgataacaaagtcatcgacggtgtctctcgcgaagagttcgaagcttccgttgttgggaagaagatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853978 |
cggaaagaagataaccaaatgcatcgtcgccgatgataacaaagtcatcgacggtgtctctcgcgaagagttcgaagcttccgttgttgggaagaagatt |
44853879 |
T |
 |
| Q |
219 |
gttgcagctcgccggaaggggaagaatatgtggcttcagcttgattctcctccttttccttcctttcaattcggta |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853878 |
gttgcagctcgccggaaggggaagaatatgtggcttcagcttgattctcctccttttccttcctttcaattcggta |
44853803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University