View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14937_low_6 (Length: 304)
Name: NF14937_low_6
Description: NF14937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14937_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 10554241 - 10554440
Alignment:
| Q |
1 |
tatacctgaggagcaaatatcggtttggatatggggtttccataactgagatactnnnnnnntcaacatgttgagctgcaatccttgaagcacaccaatg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
10554241 |
tatacctgaggaggaaatatcggtttggatatggggtttccataactgagatactaaaaaaatcaacatgttgagctgcaatccttgaagca----aatg |
10554336 |
T |
 |
| Q |
101 |
gaaactagctcaaatccgagaaattatgatgacggtaaaacaattgacaatactctttacaagtagatggtaggaagcatcaaatatgcttgcaattcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10554337 |
gaaactagctcaaatccgagaaatgatgatgacggtaaaaaaattgacaatactctttacaagtagatggtaggaagcatcaaatatgctttcaattcaa |
10554436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University