View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14937_low_9 (Length: 249)
Name: NF14937_low_9
Description: NF14937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14937_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 7036736 - 7036526
Alignment:
| Q |
1 |
agcttggagattatttcagaataaaatagctaccaaagataacttatttagaagaggagtcgtaggtcaaggatcccttcagtgtgtaggagattgtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7036736 |
agcttggagattatttcagaataaaatagctaccaaagataacttatttagaagaggagtcgtaggtcaaggatcccttcagtgtgtaggagattgtgga |
7036637 |
T |
 |
| Q |
101 |
gttaaagaatcggtttctcgtccnnnnnnnnnagtgtccggttttggtagctaggagtttcctcggtatttcaaaaagatatcttgttgcatttagatca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7036636 |
gttaaagaatcggtttctcgtcctttttttttagtgtccggttttggtagctaggagtttcctcggtatttcaaaaagatatcttgttgcatttagatca |
7036537 |
T |
 |
| Q |
201 |
atttgaaggac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
7036536 |
atttgaaggac |
7036526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University