View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14938_low_13 (Length: 236)
Name: NF14938_low_13
Description: NF14938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14938_low_13 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 153565 - 153345
Alignment:
| Q |
1 |
aaataccaaactcatgttgttttcaagaactttgactaaatactcactatgtggtattctatgatctaatatctcgtaaacttctttcactgatgagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153565 |
aaataccaaactcatgttgttttcaagaactttgactaaatactcactatgtggtattctatgatctaatatctcgtaaacttctttcactgatgagaat |
153466 |
T |
|
| Q |
101 |
tttctcttttccaaaaatacccttttgcatgtgtttggtgtcatttcaattataacaccgtgaccgaaactatacctttcgaaatcactataaacaaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
153465 |
tttctcttttccaaaaatacccttttgcatgtgtttggtgtcatttcgattaaaacaccttgaccaaaactatacctttcgaaatcactatagacaaaac |
153366 |
T |
|
| Q |
201 |
tacccttttgcatgttggaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
153365 |
tacccttttgcatgttggaac |
153345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University