View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14938_low_4 (Length: 463)
Name: NF14938_low_4
Description: NF14938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14938_low_4 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 64 - 459
Target Start/End: Complemental strand, 154021 - 153626
Alignment:
| Q |
64 |
agtcgactgaagttgtaacaagtgatgataacaatccgctgcagttggtctttgttctggattctgttccatacaccaattctgtaactctcttaacatc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154021 |
agtcgactgaagttgtaacaagtgatgataacaatccgctgcagttggtctttgttctggattctgttccatacaccaattctgtaactctcttaacatc |
153922 |
T |
|
| Q |
164 |
tttggcacattcaccaacccacatgccattatcaaatacccaacactccatacaactactttcacaccatgtaatccacgctccatttctggcgcgtgtc |
263 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
153921 |
tttggcacattcaccaacccacatgtcattatcaaatacccaacactccacacatcaactttcacaccatgcaatccacgctccatttctggcgcgtgtc |
153822 |
T |
|
| Q |
264 |
ttccacgctccaccataccaccttcatgattctcctttacatatttccctaactccggcgcaccggccgcttcgtcgaaaccactcacaaaccattctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153821 |
ttccacgctccaccataccaccttcatgattatcctttacatatttccctagctccggcgctccggccgcttcgtcgaaaccactcacaaaccattctcc |
153722 |
T |
|
| Q |
364 |
tccttctctatcatttctcattgtaaccttttcccaacatagatctctatgcatgaatgataagtcatgtaatgcaaccaaagcttttgttacata |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
153721 |
tccttctctatcatttctcattgtaaccttttcccaacatagatctctatgcatgaatgataagtcatgtaatgcaactaaagcttttgttacata |
153626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University