View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14938_low_9 (Length: 282)
Name: NF14938_low_9
Description: NF14938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14938_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 265
Target Start/End: Complemental strand, 25995374 - 25995112
Alignment:
| Q |
11 |
cacagacctttaatttaatggccatttaatagtatttgtacgaagcaagtttacttttatggttcgtaatgaacaacacagttgaaagttggc------- |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25995374 |
cacagacctttaatttaatggccatttaatagtatttgtacgaagcaagtttacttttatggttcgtaatgaacaacacagttgaaagttggcatagccg |
25995275 |
T |
 |
| Q |
104 |
-ataggtttgaatccggcaccatgaaaaataagtttaatcacagttttaatctatctattttcatcactaatgtaatttgaaccgtannnnnnnnnnnng |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| || | |
|
|
| T |
25995274 |
cataggtttgaatccggcaccatgaaaaataagtttaatcacagttttaatcaatctattttcatcactaatgtaattcgaaccctattttttctttttg |
25995175 |
T |
 |
| Q |
203 |
agggagctagtcccctattttaaaaataagatgtaattagtcccctaatctttctattttcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25995174 |
agggagctagtcccctattttaaaaatatgatgtaattagtcccctaatctttctattttcat |
25995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University