View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14939_high_6 (Length: 364)
Name: NF14939_high_6
Description: NF14939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14939_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 23895627 - 23895876
Alignment:
| Q |
1 |
gtttctcagtttcagagagaaacnnnnnnntgggtactccgcagaaggagaatgaaagcaagggcttcttctccgcgatgtcttcccgtttttccgtctt |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23895627 |
gtttcttagtttcagagagaaacaaaaaaatgggtactccgcagaaggagaatgaaagcaagggcttcttctccgcgatgtcttcccgtttttccgtctt |
23895726 |
T |
 |
| Q |
101 |
cagcaacgctatgacccgatctgttaacgggtaacttccccttccttaattcacctccaaaaccccttcaa---ttttttatgatttatataattcatta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
23895727 |
cagcaacgctatgacccgatctgttaacgggtaacttccccttccttaattcacctccaaaaccccttcaatttttttttatgatttatataattcataa |
23895826 |
T |
 |
| Q |
198 |
attcatcaagattggtcaattttagtttaatcactaatacatgctatgca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23895827 |
attcatcaagattggtcaattttagtttaatcactaatacatgctatgca |
23895876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 289 - 355
Target Start/End: Original strand, 23895919 - 23895985
Alignment:
| Q |
289 |
ggcttcttggatatgaaggtgtagaagttataaacccagatggtggtaaagatgatgtagatgatga |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23895919 |
ggcttcttggatatgaaggtgtagaagttataaacccagatggtggtaaagatgatgtagatgatga |
23895985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University