View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14939_low_10 (Length: 304)
Name: NF14939_low_10
Description: NF14939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14939_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 107 - 290
Target Start/End: Complemental strand, 38127771 - 38127588
Alignment:
| Q |
107 |
aagtcaatagggtcacacgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccattatttcttgatcattttgatca |
206 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38127771 |
aagtcaataaggtcacatgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccgttatttcttgatcattttgatca |
38127672 |
T |
|
| Q |
207 |
cagatgaaattaattcattttactttctctnnnnnnnnnnnngtaatactctaacaaaacataaataaacaatcacattcattc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38127671 |
cagatgaaattaattcattttactttctctaaaaaagaaaaagtaatactctaacaaaacataaataaacaatcatattcattc |
38127588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 26 - 112
Target Start/End: Complemental strand, 38128081 - 38127995
Alignment:
| Q |
26 |
acctcaacataccacagaacacagatggttgaaaccccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38128081 |
acctcaacataccgcagaacacagatggttgaaaacccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca |
38127995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 184
Target Start/End: Original strand, 43970089 - 43970142
Alignment:
| Q |
131 |
ttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccat |
184 |
Q |
| |
|
|||||||||| ||||||||| || |||| |||||| ||||||||||||||||| |
|
|
| T |
43970089 |
ttgctagagcgtccttatccaatcctagcccccatattttctatgatgtaccat |
43970142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University