View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_high_20 (Length: 305)
Name: NF1493_high_20
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_high_20 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 297
Target Start/End: Complemental strand, 73560 - 73272
Alignment:
| Q |
18 |
gtttttgttggtgtttatgatggtcatggtggtcctgaagcttctaagtttgttaatgatcatctctttcatcatctcataagtgagtcttaattttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73560 |
gtttttgttggtgtttatgatggtcatggtggtcctgaagcttctaagtttgttaatgatcatctctttcatcatctcataagtgagtcttaattttatt |
73461 |
T |
 |
| Q |
118 |
gttttatatttgttctctatcacgctatctgatcgaaggcgtgtccagtctctggcacgtatcagtgtttga---------catgacactgacacatgtg |
208 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
73460 |
gtcttatattttttctctatcacgctatctgatcgaaggcgtgtccagtctctggcacgtgtcagtgtttgacatgtttgacatgacactgacacatgtg |
73361 |
T |
 |
| Q |
209 |
atttgaattatgtcattttttcatgttattatttgagttgacatatcggtgtctctgatatgtctggtgtccgtgactgtgtctgtgct |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73360 |
atttgaattatgtcattttttcatgttattatttgagttgacatatcggtgtctctgatatgtctggtgtccgtgactgtgtctgtgct |
73272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 31682222 - 31682187
Alignment:
| Q |
20 |
ttttgttggtgtttatgatggtcatggtggtcctga |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31682222 |
ttttgttggtgtttatgatggtcatggtggtcctga |
31682187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 40327349 - 40327300
Alignment:
| Q |
27 |
ggtgtttatgatggtcatggtggtcctgaagcttctaagtttgttaatga |
76 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
40327349 |
ggtgtttatgatggtcatggtggaactgcagcttctcagtttgttaatga |
40327300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 48356593 - 48356629
Alignment:
| Q |
27 |
ggtgtttatgatggtcatggtggtcctgaagcttcta |
63 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48356593 |
ggtgtttatgacggtcatggtggtcctgaagcttcta |
48356629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 28939769 - 28939727
Alignment:
| Q |
20 |
ttttgttggtgtttatgatggtcatggtggtcctgaagcttct |
62 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28939769 |
ttttattggtgtttatgatggtcatggtggagctgaagcttct |
28939727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University