View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1493_high_34 (Length: 233)

Name: NF1493_high_34
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1493_high_34
NF1493_high_34
[»] chr1 (2 HSPs)
chr1 (14-203)||(52704059-52704248)
chr1 (203-233)||(52704297-52704327)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 52704059 - 52704248
Alignment:
14 agaagtagatacaacgatgagggaggaagccttgttaaaagtgtagatagaatggtcagtggtcgaggaatttgtcttcttgtagtccatccaacatcat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52704059 agaagtagatacaacgatgagggaggaagccttgttaaaagtgtagatagaatggtcagtggtcgaggaatttgtcttcttgtagtccatccaacatcat 52704158  T
114 tgtttgtattaaagacaatggttgtaacgattgcacttcacaacgaattttcgaagataaacttgtgataaaatgattcaaatgaaatga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
52704159 tgtttgtattaaagacaatggttgtaacgattgcacttcacaacgaattttcgaagataaacttgagataaaatgattcaaatgaaatga 52704248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 233
Target Start/End: Original strand, 52704297 - 52704327
Alignment:
203 atgtgtttattgtgtctttctttgcgagctt 233  Q
    |||||||||||||||||||||||||||||||    
52704297 atgtgtttattgtgtctttctttgcgagctt 52704327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University