View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_high_34 (Length: 233)
Name: NF1493_high_34
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 52704059 - 52704248
Alignment:
| Q |
14 |
agaagtagatacaacgatgagggaggaagccttgttaaaagtgtagatagaatggtcagtggtcgaggaatttgtcttcttgtagtccatccaacatcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52704059 |
agaagtagatacaacgatgagggaggaagccttgttaaaagtgtagatagaatggtcagtggtcgaggaatttgtcttcttgtagtccatccaacatcat |
52704158 |
T |
|
| Q |
114 |
tgtttgtattaaagacaatggttgtaacgattgcacttcacaacgaattttcgaagataaacttgtgataaaatgattcaaatgaaatga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52704159 |
tgtttgtattaaagacaatggttgtaacgattgcacttcacaacgaattttcgaagataaacttgagataaaatgattcaaatgaaatga |
52704248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 233
Target Start/End: Original strand, 52704297 - 52704327
Alignment:
| Q |
203 |
atgtgtttattgtgtctttctttgcgagctt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52704297 |
atgtgtttattgtgtctttctttgcgagctt |
52704327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University