View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_low_21 (Length: 309)
Name: NF1493_low_21
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 13 - 103
Target Start/End: Complemental strand, 45462986 - 45462896
Alignment:
| Q |
13 |
aatatcaacgagtgaggacttgtgaatactcacaccaagaatctgacaactctgtgtgcgcaatgaagatgcttcccttaactacaaaagc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462986 |
aatatcaacgagtgaggacttgtgaatactcacaccaagaatctgacaactctgtgtgcgcaatgaagatgcttcccttaactacaaaagc |
45462896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 213 - 295
Target Start/End: Complemental strand, 45462786 - 45462704
Alignment:
| Q |
213 |
atggttaacagctaacagcattatgtacggtgcttattccaattcattaattctcaatgttttgcttaaataatcaagtaaat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462786 |
atggttaacagctaacagcattatgtacggtgcttattccaattcattaattctcaatgttttgcttaaataatcaagtaaat |
45462704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University