View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_low_37 (Length: 245)
Name: NF1493_low_37
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 117 - 235
Target Start/End: Original strand, 2260169 - 2260287
Alignment:
| Q |
117 |
cgtgaatttattcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260169 |
cgtgaatttattcaggatggagagagagtttatggactataagaaactggggattgatttgaatcagtttatgggaagcagctcaagcattggtgcaaaa |
2260268 |
T |
|
| Q |
217 |
agagtgactaatgtctgtg |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2260269 |
agagtgactaatgtctgtg |
2260287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 2260070 - 2260107
Alignment:
| Q |
18 |
taataatcattcaatctcttattaatttcctaattaag |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260070 |
taataatcattcaatctcttattaatttcctaattaag |
2260107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 44733831 - 44733780
Alignment:
| Q |
173 |
atttgaatcagtttatgggaagcagctcaagcattggtgcaaaaagagtgac |
224 |
Q |
| |
|
|||||||||| || || || |||||||||||||||||||| ||||||||||| |
|
|
| T |
44733831 |
atttgaatcaattcattggtagcagctcaagcattggtgctaaaagagtgac |
44733780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University