View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_low_39 (Length: 238)
Name: NF1493_low_39
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_low_39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 45075139 - 45074918
Alignment:
| Q |
17 |
actatgtggaccttataccgagtcttataacaaaacagtgaaacaactcggctctggtcaatttactgagtccttggattgtaaatatgtagtatggatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45075139 |
actatgtggaccttataccgagtcttataacaaaacagtgaaacaactcggctctggtcaatttactgagtccttggattgtaaatatgtagtatggatt |
45075040 |
T |
|
| Q |
117 |
tcatttagtgggttgggcaataggatattgaccctagcttcagcatttctttacgctctcctcacagaccgtgttgtacttgttgatcctggagtggata |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45075039 |
tcatttagtgggttggggaataggatattgaccctagcttcagcatttctttacgctctcctcacagaccgtgttctacttgttgatcctggagtggata |
45074940 |
T |
|
| Q |
217 |
tgaccgatctcttttgtgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45074939 |
tgaccgatctcttttgtgaacc |
45074918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 13801791 - 13801933
Alignment:
| Q |
96 |
tgtaaatatgtagtatggatttcatttagtgggttgggcaataggatattgaccctagcttcagcatttctttacgctctcctcacagaccgtgttgtac |
195 |
Q |
| |
|
||||| || ||||| ||||||||||||||||| || || || |||||||||||| ||||||| ||||||||||| |||||||||||| | |||||| | |
|
|
| T |
13801791 |
tgtaagtacgtagtttggatttcatttagtggtttagggaacaggatattgaccttagcttctgcatttctttatgctctcctcacaaatcgtgttcttt |
13801890 |
T |
|
| Q |
196 |
ttgttgatcctggagtggatatgaccgatctcttttgtgaacc |
238 |
Q |
| |
|
| ||||| |||||||| |||||| ||| |||||||| ||||| |
|
|
| T |
13801891 |
tggttgaccctggagtcgatatggtcgacctcttttgcgaacc |
13801933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University