View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1493_low_41 (Length: 227)
Name: NF1493_low_41
Description: NF1493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1493_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 46552357 - 46552552
Alignment:
| Q |
16 |
caatattgtatccagtaaaagaatgatctggaccacatcaagtagctaccatggat--ggagaagcttttcgactgcttcaacatctcaccatgtgttta |
113 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||| |||||||| |||||||||||||||||| ||||| |||||||||||| ||| |
|
|
| T |
46552357 |
caatattgtatccagtaaaaaaatgagctggaccacatcaagtagctgccatggatatggagaagcttttcgactgtttcaagctctcaccatgtgctta |
46552456 |
T |
|
| Q |
114 |
ggaaaattaacttcaatgtgttatttttgaatttgatatatgcttacccggtgattgaaaaggtaaattttagattacgggtgtttgagtctgaga |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
46552457 |
ggaaaatcaacttcaatgtgttatttttgaatttgataaatgcttacccggtgattgaaaaagtaaattttagattacggatgtttgagtttgaga |
46552552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University