View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14940_high_21 (Length: 250)
Name: NF14940_high_21
Description: NF14940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14940_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 4247492 - 4247302
Alignment:
| Q |
11 |
cacagatgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatataatatgcatagaaaatgaacatgataaagtgattggacaaattct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4247492 |
cacagatgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatat-----gcatagaaaatgaacatgataaagtgattggacagattct |
4247398 |
T |
 |
| Q |
111 |
ccattggagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactatcggtgatttgatatcaagctcaagctaaggaccttcaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247397 |
ccattggagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactattggtgatttgatatcaagctcaagctaaggaccttcaaa |
4247302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University