View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14940_high_24 (Length: 241)
Name: NF14940_high_24
Description: NF14940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14940_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 31071902 - 31071695
Alignment:
| Q |
18 |
gtaatgtaatcagctgctagtatgaacgggtattgggattgatgtgaaattttccaacctgctgcagattattaatatgtggcaaggagttcaattttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31071902 |
gtaatgtaatcagctgctagtatgaacgggtattgggattgatgtgaaattttccaacctgctgcagattattaatatgtggcaaggagttcaattttgt |
31071803 |
T |
 |
| Q |
118 |
tttatcttctgttttctatgccattcattttctgattcggaggttttacatcattttttccttgattttgaataactcttgtatatcatacatatttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31071802 |
tttatcttctgttttctatgccattcattttctgattcggaggttttacatcattttttccttgattttgaataactcttgtatatcatacatatttggt |
31071703 |
T |
 |
| Q |
218 |
ataatttt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
31071702 |
ataatttt |
31071695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 31172518 - 31172454
Alignment:
| Q |
133 |
ctatgccattcattttctgattcggaggttttacatcattttttccttgattttgaataactctt |
197 |
Q |
| |
|
||||||||||||||||||||| || || |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
31172518 |
ctatgccattcattttctgatgcgaagtttttccatcattttttacatgattttgaataactctt |
31172454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 31067488 - 31067439
Alignment:
| Q |
21 |
atgtaatcagctgctagtatgaacgggtattgggattgatgtgaaatttt |
70 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||| | |||||||||||||| |
|
|
| T |
31067488 |
atgtaatcagctgctggtatgaaagggtgttggtactgatgtgaaatttt |
31067439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University