View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14940_low_10 (Length: 363)
Name: NF14940_low_10
Description: NF14940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14940_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 4 - 136
Target Start/End: Original strand, 46212742 - 46212874
Alignment:
| Q |
4 |
agatcaaatgattaagagactcttgagaatttgtggttaatttaatttatgtataaaaagttttacattggtatatgtgaatgaaatctttaatcaatat |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46212742 |
agatgaaatgattaagagactcttgagaatttgtggttaatttaatttatgtataaaaagttttacattggtatatgtgaatgaaatctttaatcaatat |
46212841 |
T |
|
| Q |
104 |
aaataattttacaaatgtatctagtcacatcat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46212842 |
aaataattttacaaatgtatctagtcacatcat |
46212874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 203 - 238
Target Start/End: Original strand, 46212940 - 46212975
Alignment:
| Q |
203 |
ttgacataataattggttgtatctgcaaaagttttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46212940 |
ttgacataataattggttgtatctgcaaaagttttg |
46212975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Original strand, 46213054 - 46213082
Alignment:
| Q |
318 |
ccatgattaagtgatgacatagcgagagg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46213054 |
ccatgattaagtgatgacatagcgagagg |
46213082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University