View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14940_low_16 (Length: 312)
Name: NF14940_low_16
Description: NF14940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14940_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 16627617 - 16627884
Alignment:
| Q |
1 |
gacttctatcatatcattctatttttgcgtatttattatattttggtgaaaataacaaaagaaataaatgtgaaagagacaaaggaagttgcatgacaaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16627617 |
gacttctgtcatatcattctatttttgcgtatttattatatttaggtgaaaataataaaagaaataaatgtgaaagagacaaaggaagttgcatgacaaa |
16627716 |
T |
|
| Q |
101 |
aattaatatgcataaaacaaagacgatgatgtcacatcagaaaatggatctatgacaagattttatgtgcaacaaaataagctgagctgaattgtgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16627717 |
aattaatatgcataaaacaaagacgatgatgtcacatcagaaaatggatctatgacaagattttatgtgcaacaaaataagctgagctgaattgtgaatt |
16627816 |
T |
|
| Q |
201 |
ccactaactgaattttttattatcctcgttttgtttaaaatttatgtatattgttacttttactacat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16627817 |
ccactaactgaattttttattatcctcgttttgtttaaaatttatgtatattgttacttttactacat |
16627884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University