View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14941_high_8 (Length: 374)
Name: NF14941_high_8
Description: NF14941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14941_high_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 13 - 374
Target Start/End: Complemental strand, 12571556 - 12571195
Alignment:
| Q |
13 |
aatatcatcaatcaaactatggaatatagctgcctcaatctccataaccaactcatcttgctcctcaacaaacctactccatccacctctcctatccatc |
112 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12571556 |
aatatcatcaatcaaactttgtaatatagctgcctcaatctccataaccaactcatcttgctcctcatcaaacctactccatccacctctcctatccatc |
12571457 |
T |
|
| Q |
113 |
tccttgatataagcatctttattaacatgcacaatatcataagctttttcaaatgactcatttatccaatcctcagcaattttcattatctccaactcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12571456 |
tccttgatataagcatctttattaacatgcacaatatcataagctttttcaaatgactcatttatccaatcctcagcaattttcattatctccaactcaa |
12571357 |
T |
|
| Q |
213 |
gcccctcattattcctcttttggtttctattaccacttagttcttccttgaaaaattccagaagaactatatctaaattgtcgtcgcaactttgcaccga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12571356 |
gcccctcattattcctcttttggtttctattaccacttagttcttccttgaaaaattccagcagaactatatctaaattgtcgtcgcaattttgcaccga |
12571257 |
T |
|
| Q |
313 |
tgaacttgttgctttgacaatatgtagtagttgctttgccctttcctcaatccaatcttgtt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12571256 |
tgaacttgttgctttgacaatatgtagtaattgctttgccctttcctcaatccaatcttgtt |
12571195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University