View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14941_low_11 (Length: 312)
Name: NF14941_low_11
Description: NF14941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14941_low_11 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 312
Target Start/End: Complemental strand, 40130706 - 40130411
Alignment:
| Q |
17 |
atcattctcctctgcatgattttccatgcagtttatagtttttaccactgaactgacacttcacgaacaatattgttttgtatacaatcagggaccttag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40130706 |
atcattctcctctgcatgattttccatgcagtttatagtttttaccactgaactgacacttcacgaacaatattgttttgtatacaatcagggaccttag |
40130607 |
T |
 |
| Q |
117 |
tcgtaacatcatcactggttctatacctcaacaatgggctaaaatgaacttggttgatttgtaagaactttctgctatgcacattttgatcattgcctct |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40130606 |
tcgtaacatcatcactggttctatccctcaacaatgggctaaaatgaacttggttgatttgtaagaactttctgctatgcacattttggtcattgcctct |
40130507 |
T |
 |
| Q |
217 |
taaatttcttctttttcaagtaagcaaactgaaagtgacactaaagtttgttgtgtattgaatatgcagatctttcatgggaaacagattgtcagg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40130506 |
taaatttcttctttttcaagtaagcaaattgaaagtgacactaaagtttgttgtgtattgaatatgcagatctttcatgggaaacagattttcagg |
40130411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 210 - 305
Target Start/End: Original strand, 39490034 - 39490124
Alignment:
| Q |
210 |
tgcctcttaaatttcttctttttcaagtaagcaaactgaaagtgacactaaagtttgttgtgtattgaatatgcagatctttcatgggaaacagat |
305 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||| ||| |||||||||||||||||||||||| |||||||| || ||| |||||||| |||| |
|
|
| T |
39490034 |
tgcctcttaagtttcttctttttcaactaa----actaaaa-tgacactaaagtttgttgtgtattcaatatgcacatttttaatgggaaatagat |
39490124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 210 - 305
Target Start/End: Original strand, 39501224 - 39501314
Alignment:
| Q |
210 |
tgcctcttaaatttcttctttttcaagtaagcaaactgaaagtgacactaaagtttgttgtgtattgaatatgcagatctttcatgggaaacagat |
305 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||| ||| |||||||||||||||||||||||| |||||||| || ||| |||||||| |||| |
|
|
| T |
39501224 |
tgcctcttaagtttcttctttttcaactaa----actaaaa-tgacactaaagtttgttgtgtattcaatatgcacatttttaatgggaaatagat |
39501314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University