View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14941_low_15 (Length: 209)
Name: NF14941_low_15
Description: NF14941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14941_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 61 - 194
Target Start/End: Original strand, 7907565 - 7907698
Alignment:
| Q |
61 |
atttttccaactgcatcaaacattttaatctccttgttctccaactccattgagtaatttatttagtaattaaccaaacctagtcatgtttctcttcata |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| | ||| ||||||||||||||||| |
|
|
| T |
7907565 |
atttttccaactacatcaaacattttaatctccttgttctccaactccattgaataatttatttagtaattgaccataactaatcatgtttctcttcata |
7907664 |
T |
 |
| Q |
161 |
cttggagcatacaagacctcataaatgatagatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7907665 |
cttggagcatacaagacctcataaatgatagatt |
7907698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University