View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_high_12 (Length: 267)
Name: NF14942_high_12
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 2245521 - 2245439
Alignment:
| Q |
11 |
aaagaagcaagtaaataatattcacacgcatttgaccagtactactcaatttagctcaacaataacaatcatgtacaattact |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245521 |
aaagaagcaagtaaataatattcacacgcatttgactagtactactcaatttagctcaacaataacaatcatgtacaattact |
2245439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 2245381 - 2245271
Alignment:
| Q |
151 |
ccatatggttttagattctgccttaattgacatatatataatatactgtacnnnnnnngttttcattccagaaaaccagaaaatccgttgtgaacattat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245381 |
ccatatggttttagattctgccttaattggcatatatata---tacttt---ttttttgttttcattccagaaaaccagaaaatccgttgtgaacattat |
2245288 |
T |
 |
| Q |
251 |
tcttcattcttgctaac |
267 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2245287 |
tcttcattcttgctaac |
2245271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University