View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_high_17 (Length: 235)
Name: NF14942_high_17
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 36467698 - 36467903
Alignment:
| Q |
15 |
cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467698 |
cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt |
36467797 |
T |
|
| Q |
115 |
attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36467798 |
attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga |
36467897 |
T |
|
| Q |
215 |
tctgtg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
36467898 |
tctgtg |
36467903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University