View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_high_19 (Length: 222)
Name: NF14942_high_19
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34046795 - 34046574
Alignment:
| Q |
1 |
tttgactttggtttgacattcatttgtgtagtccatttagaagtctcaaaatgaatttgttttactttgaaagatgttgacgacaagataaaattctacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34046795 |
tttgactttggtttgacattcatttgtgtagtccatttagaagtctcaaaatgaatttgttttactttgaaagatgctgacgacaagataaaattctacc |
34046696 |
T |
|
| Q |
101 |
-gtggaagtggtttcttagaagactttcagttattcttgtaattagtatgactgaaagatgaaacctattttatgtaggattacaatagtcggtgagaac |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34046695 |
cgtggaagtggtttcttagaagactttcggttattcttgtaatcagtatgagtgaaagatgaaacctattttatgtaggattacaatagtcggtgagaac |
34046596 |
T |
|
| Q |
200 |
aactatgaaaggctgaactaca |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34046595 |
aactatgaaaggctgaactaca |
34046574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University