View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_10 (Length: 300)
Name: NF14942_low_10
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 26258251 - 26258523
Alignment:
| Q |
14 |
agaccacaccggggcattccagctccaacatgttctttgctcgtgtgacgacatcaaaaccatctcctgagagggagaggttgatgtcggcatcacgctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26258251 |
agaccacaccggggcattccagctccaacatgttctttgctcgtgtgacgacctcaaaaccgtctcctgagagggagaggttgatgtcggcatcacgttc |
26258350 |
T |
 |
| Q |
114 |
tgccttgttgaaagaattggaggatactaggacagatgcatcacaacctccaatcatgcaatcgctgaagaagaggcggagtgcagcgccagcggttgaa |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258351 |
tgccttgttgaaggaattggaggatactaggacagatgcatcacaacctccaatcatgcaatcgctgaagaagaggcggagtgcagcgccagcggttgaa |
26258450 |
T |
 |
| Q |
214 |
ggtgttgttttctgcttatcagttacggtttgcttgacgatgtcttcaaatttaggacatgatttttggtagt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258451 |
ggtgttgttttctgcttatcagttacggtttgcttgacgatgtcttcaaatttaggacatgatttttggtagt |
26258523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University