View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14942_low_16 (Length: 262)
Name: NF14942_low_16
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14942_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 133 - 239
Target Start/End: Complemental strand, 51901332 - 51901227
Alignment:
| Q |
133 |
gaatgcagattaacttcatgagagcattgtaagttaaagaggggtttggtaaactaattttttgaacaaagtgcatgatggaaaattatttcggtgaccc |
232 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901332 |
gaatgcagattaacttcataagagcattgtaagttaa-gaggggtttggtaaactaattttttgaacaaagtgcatgatggaaaattatttcggtgaccc |
51901234 |
T |
|
| Q |
233 |
atgaatg |
239 |
Q |
| |
|
||||||| |
|
|
| T |
51901233 |
atgaatg |
51901227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 111
Target Start/End: Complemental strand, 51901432 - 51901393
Alignment:
| Q |
72 |
tattagtagaaaatttgtgatcttaaaaagttcagtctta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901432 |
tattagtagaaaatttgtgatcttaaaaagttcagtctta |
51901393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 78
Target Start/End: Complemental strand, 51901482 - 51901445
Alignment:
| Q |
41 |
ataatactcatgatggttgccacgtttctactattagt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51901482 |
ataatactcatgatggttgccacgtttctactagtagt |
51901445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University